Antibody Panels and Kits

46 – 60 of 1,281 results

MilliporeSigma™ Ca_V1.2 (818-835), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody in PBS, 5% sucrose, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Antigen	Ca_V1.2 (818-835)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunocytochemistry,Immunohistochemistry,Immunoprecipitation
Form	Purified
Formulation	50μl antibody in PBS, 5% sucrose, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Immunogen	a synthetic peptide [(C)TTKINMDDLQPSENEDKS] corresponding to amino acids 848-865 of α_1C-subunit of rat brain voltage-gated calcium channels,conjugated to KLH
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the ∽190kDa and ∽210 forms of the α_1C-subunit. Supplied with a control peptide. Note: The α-subunit is highly sensitive to proteases. Please refer to the data sheet for proper sample preparation.

BD Biosciences Mouse IL-4 ELISPOT Pair, BD

Convenient set of unlabelled anti-IL-4 capture antibody and a biotinylated anti-IL-4 detection antibody

Pricing & Availability

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

MilliporeSigma™ Upstate™ Histone H3 (CT), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Inhibition Assays,Western Blot
Form	Serum
Gene Accession No.	Q16695
Includes	This ChIPAb+ Histone H3 (C-Term) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H3 (CT)
Regulatory Status	RUO
Gene Symbols	HIST3H3, H3FT, MGC126886, H3t, MGC126888, H3T, H3/g, H3.4, H3/t
Purification Method	Unpurified
Gene ID (Entrez)	NM_002107.3
Formulation	Anti-Histone H3 (C-Term) (rabbit polyclonal). One vial containing 25μL of rabbit antiserum diluted 1:2 in storage buffer (0.02M Phosphate, 0.25M NaCl, 0.1% sodium azide) before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL of antiserum containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of 5μM of each primer specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	KLH-conjugated,synthetic peptide corresponding to the C-terminus of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes C-Terminal region of Histone H3, Mr 17kDa

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

BD Biosciences Human IL-4 ELISPOT Pair, BD

Convenient set of unlabelled anti-IL-4 capture antibody and a biotinylated anti-IL-4 detection antibody

Pricing & Availability

Novus Biologicals™ Autophagy Antibody Pack

For Research applications

Pricing & Availability

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9) Purified, Rabbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Immunocytochemistry,Western Blot
Form	Purified
Gene Accession No.	Q66I33
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9) Purified -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9) Purified
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B, H3F3
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9) (rabbit polyclonal IgG). One vial containing 125μg of protein A purified antibody in 125μL storage buffer containing 0.05% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers p21. One vial containing 75μL of 5μM of each primer specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: GTG GCT CTG ATT GGC TTT CTG REV: CTG AAA ACA GGC AGC CCA AG
Immunogen	The acetyl-histone H3 (Lys9) purified antibody is made against a peptide (acetylated at Lys9) corresponding to amino acids 1-12 of histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Acetyl-Histone H3 (Lys9)

BD PE Mouse NK Cell Separation Set - DM

For positive selection or depletion of NK and NK-T cells using BD IMagnet™

Pricing & Availability

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

MilliporeSigma™ Upstate™ SUZ12α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q15022
Isotype	IgG1 κ
Includes	This ChIPAb+ SUZ12 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	SUZ12α
Regulatory Status	RUO
Gene Symbols	SUZ12; JJAZ1; ChET9
Gene ID (Entrez)	NP_056170
Formulation	Anti-SUZ12 (mouse monoclonal IgG). One vial containing 50μg of protein A purified antibody in PBS containing 0.05% sodium azide. May contain 30% glycerol (see certificate of analysis). Normal Mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Immunogen	SUZ12,purified antibody is made against human SUZ12.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SUZ12, Mr 95kDa.

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability
Specifications

Antigen	Zika Virus (SPH2015) NS1
Regulatory Status	RUO
Content And Storage	Storage of components varies. See protocol for specific instructions.
Gene Alias	Zika NS1, ZIKV NS1, ZIKV-NS1
Target Species	Virus
Host Species	Mouse
Conjugate	HRP
Applications	ELISA
Product Type	Antibody Pairs
Classification	Monoclonal

MilliporeSigma™ Upstate™ LEF1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q9UJU2
Isotype	IgG1
Includes	This ChIPAb+ LEF1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	LEF1α
Regulatory Status	RUO
Gene Symbols	LEF1, DKFZp586H0919, TCF1ALPHA, LEF-1, TCF1-alpha
Gene ID (Entrez)	NM_016269.2
Formulation	Anti-LEF1 (mouse IgG1). 1 vial containing 100mg of thiophilic and size exclusion chromatography purified mouse IgG1 in 100mL of phosphate buffered saline with sodium azide. The antibody is made against amino acid residues 1-85 of human LEF1 and can recognize human and mouse LEF1. It does not cross-react with TCF-3 or TCF-4. Normal Mouse IgG. One vial containing 125μg of normal mouse IgG in 125μL volume. ChIP primers c-myc. One vial containing 75mL of 5μM of each control primer specific for human c-myc promoter. FOR: CCC AAA AAA AGG CAC GGA A; REV: TAT TGG AAA TGC GGT CAT GC
Immunogen	The antibody is made against amino acid residues 1-85 of human LEF1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes LEF1 (lymphoid enhancer-binding factor 1).

BD Biotin Mouse CD8 T Lymphocyte Enrichment Set - DM

Negative selection of CD8 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

MilliporeSigma™ Upstate™ Dimethyl-Histone H3 (Lys4)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for up to 12 months; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	Multiplex,ChIP sequencing (ChIP-seq),Dot Blot,Immunoassay,Western Blot
Form	Purified
Gene Accession No.	Q66I33
Isotype	IgG2b κ
Includes	This ChIPAb+ Dimethyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Dimethyl-Histone H3 (Lys4)α
Regulatory Status	RUO
Gene ID (Entrez)	NM_003493
Formulation	Anti-dimethyl-Histone H3 (Lys4) (mouse monoclonal IgG1, clone CMA303). One vial containing 50μg of protein G purified antibody in 50μL PBS containing 0.05% sodium azide. Normal Mouse IgG. Two vials containing 25μg purified Mouse IgG in 25μL storage buffer containing 0.1% sodium azide. ChIP Primers GAPDH Coding. One vial containing 75μL of 5μM of each primer specific for the coding region human GAPDH. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Immunogen	The dimethyl-histone H3 (Lys4) purified antibody is made against a synthetic peptide (dimethylated at Lys4) corresponding to amino acids 1-12 of histone H3.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, dimethylated at lysine 4.

Welcome to fishersci.com

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Novus Biologicals™ Autophagy Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ Autophagy Antibody Pack

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™